|  Help  |  About  |  Contact Us

Allele : Prss56<em2(IMPC)J> serine protease 56; endonuclease-mediated mutation 2, Jackson

Primary Identifier  MGI:6157340 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prss56
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTAGGTTCCATCGTCCTTG, TTTGAAGGTCCAAGTGGAAG, GCAGGGCCACCCAATCCGAT and GTGTGGCTGTTGTGACCCAA, which resulted in a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000985401 and ENSMUSE00001040282 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 9 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele