|  Help  |  About  |  Contact Us

Allele : Notum<em1(IMPC)Tcp> notum palmitoleoyl-protein carboxylesterase; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156499 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Notum
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0445 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CGCAAAAGGAACGCACAAGC and AGGGCTTGAGGATTCCGGTT targeting the 5' side and CCTGCCCTGTCTTAATGGGC and GTGCAAGAGGCCCTGCTAGG targeting the 3' side of a critical region. This resulted in a 221 bp deletion of Chr11 from 120657737 to 120658957.(GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele