|  Help  |  About  |  Contact Us

Allele : Mrpl12<em1(IMPC)Tcp> mitochondrial ribosomal protein L12; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156503 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mrpl12
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1019 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTATTGCAGACATAGTCGT targeting the 5' side and ACTGCCCGACTCAATAACTT targeting the 3' side of a critical exon. This resulted in a 742-bp del Chr11:120485061 to 120485802_insATAG. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele