|  Help  |  About  |  Contact Us

Allele : Tmem121b<em1(IMPC)Tcp> transmembrane protein 121B; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156511 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem121b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of a critical region. This resulted in a 1,842-bp deletion of Chr6 from 120492099 to 120493940_insTGAGCTGGGGGAGCGC (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele