| Primary Identifier | MGI:6157546 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tasor2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AAGAAAGCCCAGTATACAGA and AGAACGTGATAAGCTTATGT, which resulted in a 171 bp deletion beginning at Chromosome 13 position 3,596,750 bp and ending after 3,596,920 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000618996 (exon 6) and 70 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 7 amino acids later. |