|  Help  |  About  |  Contact Us

Allele : Ints3<em1(IMPC)J> integrator complex subunit 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6161377 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ints3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGAAATGAGCTCAGCAG, AATCTCTTCAGTCATCCCGA, GTTCTCCATCTGCCACCATC and TTACATCCTAAAAGAGAGAA, which resulted in a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000457114 (exon 6) and 393 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 172 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele