| Primary Identifier | MGI:6161399 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Safb2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCCCAGCGTCAAGCAC and GTTGCAGAGTCACTGTCAGC, which resulted in a 317 bp deletion beginning at Chromosome 17 position 56,582,960 bp and ending after 56,583,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220258 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 25 amino acids later. |