| Primary Identifier | MGI:6187930 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ripk3 |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 5 bp deletion (TCCGC) was created in exon 3 using sgRNAs (targeting AACCCGAGTGCCCTCGGCCC and AGGTCCCGGTGCAGGAGCGG) with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.L75Afs*8). This mutation was created in oocytes containing the Rnf31tm1.1Kiwa allele. These two genes are tightly linked on chromosome 14. |
