| Primary Identifier | MGI:6188020 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Utp20 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGATACAGTAAACTAACA, GCAGCAGGTCTACCAGCAGC, GAGAAAGTGCAATGTACACC and GCATCTTAGGACAAGGATAA, which resulted in a 691 bp deletion beginning at Chromosome 10 position 88,821,559 bp and ending after 88,822,249 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000608557 and ENSMUSE00000608556 (exons 3 and 4) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 11 amino acids later. |
