|  Help  |  About  |  Contact Us

Allele : Mical3<em1(IMPC)J> microtubule associated monooxygenase, calponin and LIM domain containing 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6188966 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mical3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGAAGGCAGGTTATAGACCA, GCTTGAGGTAGACATGCCAG, TTTTGTACAAGAGCCCCACT and AGATCGGCAAAACTTAAATG, which resulted in a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001050613 (exon 3) and 443 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 88 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele