| Primary Identifier | MGI:6188966 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mical3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGAAGGCAGGTTATAGACCA, GCTTGAGGTAGACATGCCAG, TTTTGTACAAGAGCCCCACT and AGATCGGCAAAACTTAAATG, which resulted in a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001050613 (exon 3) and 443 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 88 and early truncation 6 amino acids later. |
