| Primary Identifier | MGI:6189558 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Xylt1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CATTTGAACAGAACCCCAGA, CCGAGATCATATCTGCTAAA, TGGTCACTGTGAGCGTGGAG and TCAGGGTTTGAGGTGCAGTG, which resulted in a 991 bp deletion beginning at Chromosome 7 position 117,548,302 bp and ending after 117,549,292 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256104 (exon 3) and 477 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 104 amino acids later. |