| Primary Identifier | MGI:6189597 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttc7b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATAACACATTCAACAGAACG, CCTGAGCACCTCACGCCCCG, GTGGATACACTGATCAGGCA and TCTTGGAGTCCATAACTATG, which resulted in a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411339 (exon 2) and 364 bp of flanking intronic sequence including the splice acceptor and donor. There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion. This exon deletion is predicted to cause a change of amino acid sequence after residue 40 and early truncation 21 amino acids later. |
