|  Help  |  About  |  Contact Us

Allele : Ttc7b<em1(IMPC)J> tetratricopeptide repeat domain 7B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6189597 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ttc7b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATAACACATTCAACAGAACG, CCTGAGCACCTCACGCCCCG, GTGGATACACTGATCAGGCA and TCTTGGAGTCCATAACTATG, which resulted in a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411339 (exon 2) and 364 bp of flanking intronic sequence including the splice acceptor and donor. There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion. This exon deletion is predicted to cause a change of amino acid sequence after residue 40 and early truncation 21 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele