| Primary Identifier | MGI:6189603 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zer1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGCGGTCCCTGTGTGCCA, CTCCACCCATAGAGAAACAA, GCAAAGGCCCCCTAAGCCTG and GCTCTCACTTCTTGATGGAA, which resulted in a 1269 bp deletion beginning at Chromosome 2 position 30,108,607 bp and ending after 30,108,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234186, ENSMUSE00001310927, ENSMUSE00000285938 (exons 6-8) and 832 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 320 and early truncation 7 amino acids later. |
