| Primary Identifier | MGI:6200233 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rasgef1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACGTTCAGAATGCTTTA and GATAAGCCTGTGAATGCGCA, which resulted in a 501 bp deletion beginning at Chromosome 5 position 99,231,939 bp and ending after 99,232,439 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001389974, ENSMUSE00001391017 (exons 7 and 8) and 302 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 243 and early truncation 2 amino acids later. |