|  Help  |  About  |  Contact Us

Allele : Myzap<em1(IMPC)J> myocardial zonula adherens protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6200294 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Myzap
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGACTTCGAGCAACTCAG, TCCCTGTTCACACATCCACT, GACTTCGAGCAACTCAGAGG and CTAGGCAGAGGATGAACACC, which resulted in a 166 bp deletion beginning at Chromosome 9 position 71,548,688 bp and ending after 71,548,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216161 (exon 9) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 311 and early truncation 19 amino acids later. In addition, there is a single bp A insertion at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele