| Primary Identifier | MGI:6200424 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspyl1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTCCCCTCGTCCCGCTCC and GCTCCCTTATTGGGCGACGT, which resulted in a 1076 bp deletion beginning at Chromosome 10 position 34,282,295 bp and ending after 34,283,370 bp (GRCm38/mm10). This mutation deletes 1076 bp of ENSMUSE00000350290 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 57 amino acids later. |
