| Primary Identifier | MGI:6200351 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gk2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCATGACGTTATTAAT and AGCCTCGAAGCAAACCTCTG, which resulted in a 1622 bp deletion beginning at Chromosome 5 position 97,455,345 bp and ending after 97,456,966 bp (GRCm38/mm10). This mutation deletes 1622 bp from ENSMUSE00000356565 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. |
