|  Help  |  About  |  Contact Us

Allele : Tnrc6c<em1(IMPC)J> trinucleotide repeat containing 6C; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6195001 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tnrc6c
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTATAAACCTTCATCAGTG, ACATGTGCAATTGTGTCCAA, AGCAAACTTCTAAGTATTTT and AGTAGTATCAAACTTTGCAA, which resulted in a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10). This mutation deletes the last 5 bases of ENSMUSE00001287639 (exon 3) and 134 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 6 amino acids later, by read through into the intron.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele