| Primary Identifier | MGI:6198594 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Snx33 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACATTATCCACCTGCAGAA and GGAGGAAATCAGTATCCAGC, which resulted in a 1408 bp deletion beginning at Chromosome 9 position 56,925,315 bp and ending after 56,926,722 bp (GRCm38/mm10). This mutation deletes 1408 bp from (ENSMUSE00000340577) (exon 1) and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 6 amino acids later. |
