| Primary Identifier | MGI:6195841 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cabp2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGAAGACTGTGGGAACAG, GTGCGCTGTTCCAAACGCCC, GACACAGAAAGAGGGTGCCG and TTGTTATTAAAGGGAGAGCA, which resulted in a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145610 and ENSMUSE00000145606 (exon 2,3) and 788 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later. |
