| Primary Identifier | MGI:6195848 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGTGGACCCTGAGACC and AGGCGAGGGGCCTGATTTAC, which resulted in a 2,470 bp deletion beginning at Chromosome 9 position 108,574,104 bp and ending after 108,576,573 bp (GRCm38/mm10). This mutation deletes 2,470 bp from ENSMUSE00000240681 (exon 2) and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 31 amino acids later. |
