| Primary Identifier | MGI:6208819 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dync1li2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTGCCCATGAAGTCAACA and AAAGCATCTATGCATGGCAG, which resulted in a 490 bp deletion beginning at Chromosome 8 position 104,430,198 bp and ending after 104,430,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000228453 (exon 5) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 176 and early truncation 1 amino acid later. |
