| Primary Identifier | MGI:6208836 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aamp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCGCCTCCCATTCCACAA and CCAAACTTGCTGCAGCTCCA, which resulted in a 2087 bp deletion beginning at Chromosome 1 position 74,280,718 bp and ending after 74,282,804 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000156609-ENSMUSE00000156607 (exons 4-10) and 1252 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 6 amino acids later. |
