| Primary Identifier | MGI:6209645 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nup205 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by Microinjection Cas9 mRNA and 2 guide sequences AGGGGATATGAGGCAACACG and TGAAGCTAGAACCCCTATCT, which resulted in a 605 bp deletion beginning at Chromosome 6 position 35,186,016 bp and ending after 35,186,665 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000469332 (exon 3) and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 15 amino acids later. |
