|  Help  |  About  |  Contact Us

Allele : Cd4<em1Litt> CD4 antigen; endonuclease-mediated mutation 1, Dan R Littman

Primary Identifier  MGI:6220669 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Cd4
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and ACTGACACACCCGCTCATCA), resulting in a deletion of the "maturity" enhancer E4m, a cis regulatory element in intron 1 of the Cd4 gene (chr6:124861963-124862659 (GRCm39)).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cd4<E4mdelta>,
  • Cd4<E4mdelta>,
  • Rr95<em1Litt>,
  • Rr95<em1Litt>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele