| Primary Identifier | MGI:6278547 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atpsckmt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCACACACTAGAAAGCCA and GACTCTGAACACATGCTGGT, which resulted in a 592 bp deletion beginning at Chromosome 15 position 31,605,842 bp and ending after 31,606,433 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001310278 (exon 2) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 13 amino acids later. In addition, there is a 2 bp deletion (GT) 36 bp after the 592 bp deletion. |
