| Primary Identifier | MGI:6257438 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Msto1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1154 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GACTAAACTGATCACCTGTC targeting the 5' side and GCTCTCCGATGCACAGTAAA targeting the 3' side of a critical exon. This resulted in a 376-bp del Chr3:88912622 to 88912997_insT (GRCm38). |