|  Help  |  About  |  Contact Us

Allele : Dym<em1(IMPC)Tcp> dymeclin; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257483 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dym
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGTTGGAATCGTGCTGTC and CGTTCCCTGAGGTAGTCCTA targeting the 5' side and CAAGTGAGGAGAACTGCGTG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion of Chr18 from 75082183 to 75082187 and a 309-bp deletion of Chr18 from 75082260 to 75082568 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele