|  Help  |  About  |  Contact Us

Allele : Serpine1<em1(IMPC)Tcp> serine (or cysteine) peptidase inhibitor, clade E, member 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257653 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Serpine1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1164 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTAGACGAGCTGACACGCC targeting the 5' side and CTGAGTTCACCACCCCCGAT targeting the 3' side of a critical exon. This resulted in a 863-bp deletion Chr5:137067011 to 137067873; p.(R185Pfs*50). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele