| Primary Identifier | MGI:6266929 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | E130114P18Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTACAAAGGAGATACGCA and CTGATTGTATGATAACGCAA, which resulted in a 425 bp deletion beginning at Chromosome 4 position 97,574,571 bp and ending after 97,574,995 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276782 (exon 4) and 322 bp of flanking intronic sequence including the splice acceptor and donor. |
