| Primary Identifier | MGI:6268399 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr74 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAACGGCTTGGGCTTCCA and GATAGAGTAGGTAGGTTGCA, which resulted in a 992 bp deletion beginning at Chromosome 19 position 8,737,406 bp and ending after 8,738,397 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000235265-ENSMUSE00000235241 (exons 4-6) and 667 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 14 amino acids later. |