| Primary Identifier | MGI:6258441 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb41 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATATATACCCAAATTCACAT, ATACTTGTTGCACTGCCAAA, ATACTTTCCCTCAAATGCTT and ACTTGTGTGACGCCAGGAGC, which resulted in a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000659173 (exon 3) and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 372 and early truncation 39 amino acids later. In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site. |