|  Help  |  About  |  Contact Us

Allele : Zbtb41<em1(IMPC)J> zinc finger and BTB domain containing 41; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6258441 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zbtb41
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATATATACCCAAATTCACAT, ATACTTGTTGCACTGCCAAA, ATACTTTCCCTCAAATGCTT and ACTTGTGTGACGCCAGGAGC, which resulted in a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000659173 (exon 3) and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 372 and early truncation 39 amino acids later. In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories