|  Help  |  About  |  Contact Us

Allele : Ssu72<em1(IMPC)J> Ssu72 RNA polymerase II CTD phosphatase homolog (yeast); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6267327 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ssu72
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCTAACATGGGAAGCACA and ATACAGGTCAGAGGATGTGG, which resulted in a 439 bp deletion beginning at Chromosome 4 position 155,731,135 bp and ending after 155,731,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184815 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 23 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele