| Primary Identifier | MGI:6241425 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Insyn2a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation. |