| Primary Identifier | MGI:6258452 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Plekhj1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCACTCCCCAAAACCCA and AATCCTGGTGAGAGGAAGCT, which resulted in a 1061 bp deletion beginning at Chromosome 10 position 80,795,850 bp and ending after 80,796,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000306173, ENSMUSE00000306166 and ENSMUSE00001413139 (exons 4-6) and 469 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 48 amino acids later probably by read through after exon 3. |
