| Primary Identifier | MGI:6258455 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nufip2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTACAATACAGCTTAGTAT and GGATAGCCTTTTTTTGTATT, which resulted in a 2080 bp deletion beginning at Chromosome 11 position 77,691,456 bp and ending after 77,693,535 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000292192 (exon 2) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 delete 571 amino acids and stop 28 amino acids later. This transcript does not go out of frame but removes >80% of the coding sequence. |