|  Help  |  About  |  Contact Us

Allele : Dhx37<em1(IMPC)J> DEAH-box helicase 37; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6258465 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dhx37
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AAAACTGCCGTGGATCTCAA, AGACGAACAGAGTCTCACTA, GCACCAGCTCTCCAGATCAG and ATATTTGTCATGAGTAAGCA, which resulted in a 232 bp deletion beginning at Chromosome 5 position 125,431,557 bp and ending after 125,431,788 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001016994 (exon 2) and 62 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 9 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dhx37<->,
  • Dhx37<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele