| Primary Identifier | MGI:6269391 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc117 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGTTCTCTTAAAGCTGGG and GTCTTACATTTCGTCTATAA, which resulted in an 886 bp deletion beginning at Chromosome 11 position 5,534,174 bp and ending after 5,535,059 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000266605 and ENSMUSE00000105246 (exons 3 and 4) and 523 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to delete 121 amino acids after residue 72 and then remain in phase for the last 78 amino acids. This removes more than 45 percent of the encoded protein. |
