| Primary Identifier | MGI:6258582 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Faxc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGAGGGCAACAATCCCACA and GTAAACCTAAAAGTACCACC, which resulted in a 490 bp deletion beginning at Chromosome 4 position 21,936,545 bp and ending after 21,937,034 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283152 (exon 2) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 28 amino acids later. There is a 7 bp insertion [TTTTAAG] at the deletion site. |
