| Primary Identifier | MGI:6258650 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klhl40 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTAGGCAGATAAAAAGGG and GGACCACAGCAGCAACCAGG, which resulted in a 471 bp deletion beginning at Chromosome 9 position 121,779,701 bp and ending after 121,780,171 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000633486 (exon 2) and 310 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 384 and early truncation 5 amino acids later. |
