| Primary Identifier | MGI:6276278 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cstf1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTGGTTAGAGCAAGTGAA and TTAGATAAGATGCCATTGAG, which resulted in a 868 bp deletion beginning at Chromosome 2 position 172,375,477 bp and ending after 172,376,344 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170107 and ENSMUSE00000170105 (exons 3 and 4) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 28 amino acids later. |
