| Primary Identifier | MGI:6259583 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spc25 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTACACTCTCAGCCTTTAG, AGGTTGACTTTGCTACAGAA, GGGCCCCAAATACATCTATG and CAGACATAAACTCGAAAATG, which resulted in an 8330 bp deletion beginning at Chromosome 2 position 69,196,943 bp and ending after 69,205,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291289-ENSMUSE00000165579 (exons 2-6) and 7760 bp of flanking intronic sequence including the start site and splice acceptors and donors and is predicted to result in a null allele. In addition, there is a 57 bp insertion at the deletion site (Chr2:69,196,929-69,196,985). |
