| Primary Identifier | MGI:6259585 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ier5l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGATACCCCCATATCCGCA and CGGAGGCTCCTAGTCCCACG, which resulted in a 3057 bp deletion beginning at Chromosome 2 position 30,471,400 bp and ending after 30,474,456 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462138 (exon 1) and 374 bp of flanking intronic sequence including the transcription start site and is predicted to result in a null allele. |
