Primary Identifier | MGI:6275202 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Bpifc |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGCCATAGATTTCTCCAC and GGAAACTCCAGTCTTAAGAG, which resulted in a 562 bp deletion beginning at Chromosome 10 position 85,995,684 bp and ending after 85,996,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000398325 (exon 3) and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. |