| Primary Identifier | MGI:6275206 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc107 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATGTGAAACTCTCCAGT and CGGTAGCCTCAGAAACACAA, which resulted in a 1098 bp deletion beginning at Chromosome 4 position 43,494,976 bp and ending after 43,496,073 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230953, ENSMUSE00000179397, ENSMUSE00000179398, and ENSMUSE00000179395 (exons 3-6) and 608 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 56 amino acids later. |
