| Primary Identifier | MGI:6275189 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atg2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGCTCACTTGCTTACAGCT and ATTGTCAGTGCTCAGCACCT, which resulted in a 291 bp deletion beginning at Chromosome 12 position 105,674,819 bp and ending after 105,675,109 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000529748 (exon 2) and 128 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later. |
