| Primary Identifier | MGI:6273154 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ascl4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCTGAGTGGGATTAGAAG and CATTCAGCTCAAATGCCAAA, which resulted in a 2177 bp deletion beginning at Chromosome 10 position 85,927,535 bp and ending after 85,929,711 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912627 (exon 1) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. |
