| Primary Identifier | MGI:6294072 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dok6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTTCCTCAAGCTGTAGAT and GGCCAGTTATCACTACCCTA, which resulted in a 294 bp deletion beginning at Chromosome 18 position 89,559,906 bp and ending after 89,560,199 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000658810 (exon 3) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 19 amino acids later. There is a 5 bp insertion (GGTAG) 106 bp before the deletion. |
