|  Help  |  About  |  Contact Us

Allele : Zfp786<em1(IMPC)J> zinc finger protein 786; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6294143 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp786
Inheritance Mode  Not Specified Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACCTCTAAGGACAAAC and GTAATTTGAGACTCACAGAG, which resulted in a 404 bp deletion beginning at Chromosome 6 position 47,826,784 bp and ending after 47,827,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268428 (exon 2) and 277 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. There is a single bp (A) insertion at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele