| Primary Identifier | MGI:6281171 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ces3b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGGGCTAGAGTCCTAGCA and GGAAATATAGGAATCCGTTG, which resulted in an 863 bp deletion beginning at Chromosome 8 position 105,086,311 bp and ending after 105,087,173 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001069220 and ENSMUSE00000506460 (exons 5 and 6) and 604 of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 34 amino acids later. |